candidate cSNPS from ESTs
row mRNA(accesion no.) Gene Codon pos Base change Aminoacid change syn/rep ESTs Library(M/S) Ref
1 AF008443 POLR2C 58 C / T V / V syn ESTs M -
2 AF014955 - 104 G / A E / K rep ESTs S -
3 AF006084 - 52 C / T N / N syn ESTs S -
4 D00682 CFL1 66 T / C D / D syn ESTs M -
5 D13891 ID2 106 C / T L / L syn ESTs S -
6 D14658 - 34 G / T K / N rep ESTs S -
7 D15057 DAD1 21 G / T P / P syn ESTs S -
8 D16581 MTH1 83 G / A V / M rep ESTs S 1
9 D21235 RAD23A 186 C / T A / A syn ESTs S -
10 D25545 PCMT1 120 G / A V / I rep ESTs S 2
11 D26598 - 34 T / A L / M rep ESTs M -
12 D29643 - 122 C / T G / G syn ESTs M -
13 D38048 - 39 T / C V / A rep ESTs M -
14 D38305 - 319 G / A K / K syn ESTs M -
15 D38583 - 105 A / C T / P rep ESTs S -
16 D42073 - 280 C / T H / H syn ESTs M -
17 D45248 - 21 G / A R / R syn ESTs M -
18 D45370 - 68 C / T I / I syn ESTs M -
19 D49489 - 33 A / G S / S syn ESTs M -
20 D49489 - 142 G / A R / R syn ESTs M -
21 D49489 - 214 A / G K / R rep ESTs M -
22 D50310 - 75 A / G R / G rep ESTs M -
23 D50663 - 64 C / T I / I syn ESTs M -
24 D55716 MCM7 660 G / C V / V syn ESTs S -
25 D55716 MCM7 675 C / G V / V syn ESTs S -
26 D87292 TST 256 C / T H / H syn ESTs S -
27 D90209 CREB2 22 C / A P / Q rep ESTs M -
28 D90373 APEX 286 T / C L / L syn ESTs S -
29 D90427 AZGP1 101 T / C I / I syn ESTs M -
30 J02853 CSNK2A1 15 T / C V / V syn ESTs S -
31 J03553 SFTPC 138 A / C N / T rep ESTs S 3
32 J03553 SFTPC 186 A / G N / S rep ESTs S -
33 J03569 MDU1 317 C / T L / L syn ESTs M -
34 J04205 SSB 247 A / T E / V rep ESTs S -
35 J04599 BGN 47 A / G S / S syn ESTs M -
36 J04765 SPP1 80 T / C D / D syn ESTs S -
37 J04765 SPP1 287 G / A R / H rep ESTs M -
38 J04965 POLR2E 52 G / T R / R syn ESTs M -
39 J04973 UQCRC2 183 A / G Q / R rep ESTs M -
40 K01500 AACT 9 G / A A / T rep ESTs M 4
41 K02215 AGT 369 T / A M / K rep ESTs S -
42 K02215 AGT 268 T / C M / T rep ESTs S 5
43 K02215 AGT 207 C / T T / M rep ESTs S 5
44 L02426 - 115 T / C I / I syn ESTs M -
45 L03558 CSTB 5 G / T A / A syn ESTs S -
46 L06132 VDAC1 261 C / T A / V rep ESTs S -
47 L08187 - 201 G / A V / I rep ESTs M -
48 L08187 - 224 A / G T / T syn ESTs M -
49 L08488 INPP1 51 T / G T / T syn ESTs S -
50 L08488 INPP1 116 A / G V / V syn ESTs M -
51 L12136 - 105 C / T V / V syn ESTs M -
52 L13977 PRCP 334 T / C Y / Y syn ESTs S -
53 L13977 PRCP 492 A / G A / A syn ESTs M -
54 L16510 CTSB 84 C / T F / F syn ESTs S -
55 L18960 EIF4C 136 T / C D / D syn ESTs S -
56 L19437 TALDO1 151 G / T Q / H rep ESTs S -
57 L20688 - 168 C / G A / A syn ESTs M -
58 L25085 - 89 A / T I / F rep ESTs S -
59 L26247 SUI1 36 C / A Q / K rep ESTs S -
60 L35233 AMFR 181 A / G I / V rep ESTs M -
61 L49054 MLF1 190 C / T S / S syn ESTs M -
62 M11354 100 93 G / C L / F rep ESTs S -
63 M11791 APOA 131 A / T K / M rep ESTs S 6
64 M12654 GC 299 T / C C / C syn ESTs S -
65 M12654 GC 436 C / A T / K rep ESTs S 7
66 M13451 - 566 C / T H / H syn ESTs M -
67 M13690 C1NH 480 G / A V / M rep ESTs M 8
68 M13755 GIP2 83 G / A S / N rep ESTs M -
69 M14780 CKM 373 C / T I / I syn ESTs M -
70 M16961 AHSG 248 C / T T / M rep ESTs M 9
71 M16961 AHSG 256 C / G T / S rep ESTs M 9
72 M16961 AHSG 13 C / G L / L syn ESTs M -
73 M21984 TNNT3 154 T / G Y / D rep ESTs S -
74 M21984 TNNT3 254 C / T G / G syn ESTs S -
75 M22430 PLA2G2A 44 C / T Y / Y syn ESTs S -
76 M22815 MYL2 139 G / A A / T rep ESTs S -
77 M22960 PPGB 182 C / A I / I syn ESTs S -
78 M25897 PF4 54 C / G H / D rep ESTs M -
79 M25897 PF4 80 G / A R / R syn ESTs S -
80 M26708 PTMA 107 G / A D / N rep ESTs S -
81 M29870 RAC1 150 T / C G / G syn ESTs S -
82 M36682 LGALS3 98 C / A P / T rep ESTs M 10
83 M36682 LGALS3 64 A / C H / P rep ESTs M 10
84 M55067 NCF1 166 G / A D / N rep ESTs S -
85 M55067 NCF1 115 C / T L / L syn ESTs S -
86 M57730 EFNA1 159 T / A V / D rep ESTs M -
87 M62810 TCF6L1 12 G / C S / T rep ESTs M 11
88 M63573 PPIB 21 C / A S / S syn ESTs S -
89 M65128 FKBP2 7 G / A R / Q rep ESTs S -
90 M65212 COMT 136 C / G L / L syn ESTs M -
91 M65212 COMT 62 C / T H / H syn ESTs M -
92 M65212 COMT 158 G / A V / M rep ESTs M 12
93 M69013 GNA11 257 C / T T / T syn ESTs S -
94 M73791 - 202 G / A S / N rep ESTs M 13
95 M73791 - 122 C / T P / L rep ESTs S -
96 M74220 PLG 110 C / T N / N syn ESTs S -
97 M74220 PLG 477 C / T S / S syn ESTs S -
98 M74524 UBE2A 147 A / G Q / Q syn ESTs S -
99 M77349 TGFB1 540 T / C F / F syn ESTs M -
100 M86511 CD14 367 G / C L / L syn ESTs M -
101 M86667 NAP1L1 100 T / C H / H syn ESTs M -
102 M90657 TAAL6 135 C / T T / T syn ESTs S -
103 M94083 - 331 A / G S / S syn ESTs M -
104 S67861 GTF2E2 234 G / A E / K rep ESTs S -
105 S71513 SCYA2 35 T / C C / C syn ESTs M -
106 S76822 FDFT1 45 G / A R / K rep ESTs M 14
107 S80305 APOH 266 G / T V / L rep ESTs S 15
108 S81585 - 75 G / A L / L syn ESTs M -
109 S82024 SCG10 152 C / G A / G rep ESTs S -
110 S83285 GLO1 111 A / C E / A rep ESTs M 16
111 U03269 CAPZA2 33 C / T F / F syn ESTs M -
112 U06643 LGALS7 53 C / A P / P syn ESTs S -
113 U09202 OAZ 32 G / T R / L rep ESTs S -
114 U09510 GARS 661 A / G T / T syn ESTs M -
115 U12404 172 199 C / A Q / K rep ESTs S -
116 U15009 SNRPD3 101 C / T A / A syn ESTs S -
117 U17248 SDHB 212 C / T L / F rep ESTs S -
118 U18321 - 268 T / C L / L syn ESTs S -
119 U18423 SMN1 154 G / A Q / Q syn ESTs M -
120 U18423 SMN1 280 C / T F / F syn ESTs M -
121 U27143 HINT 105 G / A G / R rep ESTs S -
122 U27143 HINT 19 T / C F / F syn ESTs S -
123 U28386 KPNA2 267 G / A V / V syn ESTs M -
124 U30897 GSTP1 185 T / C S / S syn ESTs M -
125 U30897 GSTP1 105 G / A V / I rep ESTs M -
126 U31525 - 184 A / G P / P syn ESTs M -
127 U37690 POLR2L 33 C / T D / D syn ESTs M -
128 U38846 - 212 G / T K / N rep ESTs S -
129 U41515 - 5 G / A K / K syn ESTs S -
130 U43527 - 81 G / C R / P rep ESTs M -
131 U46751 - 292 C / T D / D syn ESTs M -
132 U46751 - 312 G / A R / R syn ESTs M -
133 U51007 - 343 C / G P / R rep ESTs S -
134 U58516 MFGE8 3 C / A R / S rep ESTs M -
135 U58996 cAST 260 C / T A / V rep ESTs S -
136 U60644 - 389 G / A A / A syn ESTs S -
137 U67963 - 251 A / G L / L syn ESTs M -
138 U70321 - 17 G / A R / K rep ESTs S -
139 U80073 - 343 A / G R / R syn ESTs M -
140 U87947 EMP3 125 A / G I / V rep ESTs M -
141 U90313 - 140 C / A A / D rep ESTs M -
142 U90549 - 66 A / G G / G syn ESTs M -
143 U90551 - 58 C / T Y / Y syn ESTs S -
144 U96915 - 65 T / C T / T syn ESTs M -
145 X00567 APOC3 34 T / C G / G syn ESTs M -
146 X02152 LDHA 173 G / A L / L syn ESTs M -
147 X02152 LDHA 161 T / C S / S syn ESTs M -
148 X02598 TIMP1 124 T / C F / F syn ESTs M -
149 X04076 CAT 419 C / T L / L syn ESTs S -
150 X07898 TNNC2 128 T / G T / T syn ESTs S -
151 X08054 GYPA 31 T / C T / T syn ESTs M -
152 X13955 MYL4 183 G / T G / V rep ESTs S -
153 X14829 LGALS1 69 G / A W / X rep ESTs S -
154 X14829 LGALS1 71 C / T T / T syn ESTs S -
155 X15002 IGFBP1 113 A / G I / M rep ESTs M 17
156 X15183 HSPCA 360 T / C N / N syn ESTs M -
157 X15341 COX6A1 60 C / T P / L rep ESTs S -
158 X15606 ICAM2 274 G / A R / R syn ESTs S -
159 X17042 PRG1 100 C / T S / S syn ESTs S -
160 X54802 COX4 76 T / C D / D syn ESTs S -
161 X55885 KDELR1 141 C / A T / T syn ESTs S -
162 X56468 - 219 C / T Q / X rep ESTs S -
163 X56740 - 184 G / T R / I rep ESTs M -
164 X56740 - 207 G / T K / N rep ESTs S -
165 X57346 YWHAB 20 C / A R / R syn ESTs S -
166 X59417 - 192 A / G E / E syn ESTs M -
167 X59445 SOD2 16 C / T A / V rep ESTs M 18
168 X64364 BSG 109 C / T A / A syn ESTs M -
169 X64707 RPL13 31 T / G R / R syn ESTs M -
170 X65614 S100P 38 G / T E / D rep ESTs S -
171 X67688 TKT1 598 A / G P / P syn ESTs M -
172 X67698 - 86 C / T P / L rep ESTs S -
173 X70218 PPP4C 241 G / T V / L rep ESTs S -
174 X75861 TEGT 121 A / G T / T syn ESTs M -
175 X76648 GLRX 47 G / T D / Y rep ESTs S -
176 X76648 GLRX 75 T / C I / I syn ESTs M -
177 X78873 PPP1R2 179 G / A D / N rep ESTs M -
178 X79353 GDI1 73 T / C N / N syn ESTs M -
179 X80909 - 181 T / A I / I syn ESTs M -
180 X80909 - 59 T / C I / I syn ESTs M -
181 X80909 - 102 A / C I / I syn ESTs M -
182 X83218 ATP5O 107 C / T N / N syn ESTs M -
183 X83218 ATP5O 129 C / T S / F rep ESTs S -
184 X83218 ATP5O 166 G / A S / N rep ESTs S -
185 X83218 ATP5O 98 A / G K / R rep ESTs S -
186 X83618 HMGCS2 385 T / A S / T rep ESTs S -
187 X89750 TGIF 226 G / C T / T syn ESTs M -
188 X90583 SSR4 21 C / T C / C syn ESTs M -
189 X93499 RAB7 73 C / T L / L syn ESTs M -
190 X93510 - 257 T / G C / G rep ESTs S -
191 X97124 PRCC 446 A / C Q / P rep ESTs S -
192 X97442 - 195 C / T F / F syn ESTs M -
193 X97442 - 64 C / A S / Y rep ESTs S -
194 X97544 - 113 G / A V / I rep ESTs M -
195 X98433 - 67 G / A L / L syn ESTs S -
196 X99920 - 14 G / T E / D rep ESTs S -
197 Y00282 RPN2 609 T / C L / L syn ESTs M -
198 Y00503 KRT19 60 G / C G / A rep ESTs M -
199 Y00503 KRT19 157 C / T N / N syn ESTs M -
200 Y12473 - 10 C / G L / V rep ESTs M -
201 Z19554 VIM 271 C / T D / D syn ESTs M -

D14658

5': TCTGACCATTTATACCTCATATAAGGAGAA

SNP: G/T

3': AGCATCTTTCTCGTGGCCCACAGGAAAGAT


M21984

5': AAGAAAGCTCTGTCTTCCATGGGAGCCAAC

SNP: T/G

3': ACAGCAGCTACCTGGCCAAGGCTGACCAGA


M21984

5': GGCTGGGACCCCAGCCAAGGGCAAAGTCGG

SNP: C/T

3': GGGCGCTGGAAGTAGAGAGGCCAGAAAGGC


X07898

5': GATTTTCAGGGCCTCCGGGGAGCACGTGAC

SNP: T/G

3': GACGAGGAGATCGAATCTCTGATGAAAGAC


M22815

5': TTTTCCAAGGAGGAGGTTGACCAGATGTTC

SNP: G/A

3': CCGCCTTCCCCCCTGACGTGACTGGCAACT


M62810

5': CGTTTCTCCGAAGCATGTGGGGCGTGCTGA

SNP: G/C

3': TGCCCTGGGAAGGTCTGGAGCAGAGCTGTG


D16581

5': GAGTTCGTGGGCGAGCCTGAGCTCATGGAC

SNP: G/A

3': TGCATGTCTTCTGCACAGACAGCATCCAGG


X08054

5': TACCACTGGTGTGGCAATGCACACTTCAAC

SNP: T/C

3': TCTTCTTCAGTCACAAAGAGTTACATCTCA


J03553

5': GGGACCCGGCCTTCCTGGGCATGGCCGTGA

SNP: A/G

3': CACCCTGTGTGGCGAGGTGCCGCTCTACTA


J03553

5': CAGAGAGCATCCCCAGTCTTGAGGCTCTCA

SNP: A/C

3': TAGAAAAGTCCACAACTTCCAGATGGAATG


D25545

5': GATCACATTAAAGAGCTAGTAGATGACTCA

SNP: G/A

3': TAAATAATGTCAGGAAGGACGATCCAACAC


M55067

5': CACCAAGATCTCCCGCTGTCCCCACCTCCT

SNP: C/T

3': GACTTCTTCAAGGTGCGCCCTGATGACCTC


M55067

5': ATCATCCTGCAGACGTACCGCGCCATTGCC

SNP: G/A

3': ACTACGAGAAGACCTCGGGCTCCGAGATGG


D45370

5': TAACCAGGCCTCTGACACCTTCTCTGGGAT

SNP: C/T

3': GGGAAAAAATTCGGCCTCCTGAAATGACAG


U70321

5': GGGGGCCTCCTCCCTGGAGATCCACCCCCA

SNP: G/A

3': AACCGACGTCTTGAGGCTGGTGCTGTATCT


AF014955

5': GAAATCCTTAAAAAAGTAAGCCAACAAACA

SNP: G/A

3': AAAAGACAACAACAGTGAAATTCAACAGAA


X13955

5': AGCTGTTAGCTGGGCAAGAGGATGCCAATG

SNP: G/T

3': CTGCATCAATTATGAAGCCTTTGTCAAGCA


M65128

5': CGAGGAGAGACATGAGGCTGAGCTGGTTCC

SNP: G/A

3': GGTCCTGACAGTACTGTCCATCTGCCTGAG


U90549

5': AAAGGGGAAAGCAGATGCTGGAAAGGATGG

SNP: A/G

3': AACAACCCTGCAAAAAACCGAGATGCCTCT


U15009

5': AGGCTCAGGGGCTGGCCGAGGAAAAGCTGC

SNP: C/T

3': ATTCTCAAGGCCCAAGTGGCCGCAAGAGGA


X98433

5': ATTTGCTGGCTACAAAGTCCCCCACCCCTT

SNP: G/A

3': GAGCACAAGATCATCATCCGAGTGCAGACC


L25085

5': CTGTTCATCGCTTCTGTATTTATGTTGCAC

SNP: A/T

3': TTTGGGGCAAGTACACTCGTTCGTAGATTC


D15057

5': GTTCTTAGAAGAGTACTTGAGCTCCACTCC

SNP: G/T

3': CAGCGTCTGAAGTTGCTGGACGCGTACCTG


U41515

5': GGCGCGGACAGTCGAGATGTCAGAGAAAAA

SNP: G/A

3': CAGCCGGTAGACTTAGGTCTGTTAGAGGAA


X78873

5': GATGAAGATGAAGAAATGTTAGAGACTGCA

SNP: G/A

3': ATGGAGAAAGCATGAATACGGAAGAATCAA


Y12473

5': ATAATGAGTTTAGCTCTGAGAAGTGAGCTT

SNP: C/G

3': TAGTGGACAAAACAAAGAGGAAAAAAAGAA


X64707

5': CGTGGCCACGTGGTTCAACCAGCCGGCCCG

SNP: T/G

3': AAGATCCGCAGACGTAAGGCCCGGCAAGCC


L49054

5': CAACCAGGAGTTCATCAATATGAATGAAAG

SNP: C/T

3': GATGCTCATGCTTTTGATGAGGAGTGGCAA


D42073

5': CCACTGGATCCTCCCTCAAGATTATGATCA

SNP: C/T

3': GCACAGGCTGAGGCCAGGCATCTGGTATAT


X93510

5': CTGCAGGGGCTGCCCGAGTGCACGCGCTGC

SNP: T/G

3': GCCACGGCATCGTGGGCACCATCGTCAAGG


U27143

5': CGAATGGTGGTGAATGAAGGTTCAGATGGT

SNP: G/A

3': GACAGTCTGTCTATCACGTTCATCTCCATG


U27143

5': GGTCGCTCGGCCTGGTGGCGACACGATCTT

SNP: T/C

3': GGGAAGATCATCCGCAAGGAAATACCAGCC


X99920

5': ACCACTGACAGAGCTAGAGGAGTCCATTGA

SNP: G/T

3': ACCGTGGTCACCACCTTCTTCACCTTTGCA


D87292

5': CACGTGCCGCAAGGGAGTCACCGCCTGCCA

SNP: C/T

3': GTGGCCTTGGCTGCCTACCTCTGCGGCAAG


X59445

5': GTGTGCGGCACCAGCAGGCAGCTGCTCCGG

SNP: C/T

3': TTTGGGGTATCTGGGCTCCAGGCAGAAGCA


D45248

5': GGAAGCCCGCAAACAGGTGGAGGTCTTCAG

SNP: G/A

3': CAGAATCTTTTCCAGGAGGCTGAGGAATTC


U67963

5': CCTGCTGCTCCAGGGCTCTGCCGATCGCCT

SNP: A/G

3': TGTGACAGCAAAGGGGCCTACCTGCTCATG


M25897

5': GTGAAGACCACCTCCCAGGTCCGTCCCAGG

SNP: C/G

3': ACATCACCAGCCTGGAGGTGATCAAGGCCG


M25897

5': CCAACTGATAGCCACGCTGAAGAATGGAAG

SNP: G/A

3': AAAATTTGCTTGGACCTGCAAGCCCCGCTG


M11791

5': TGCAGCCCTACCTGGACGACTTCCAGAAGA

SNP: A/T

3': GTGGCAGGAGGAGATGGAGCTCTACCGCCA


D38583

5': TTCCTCAAGGCTGTCCCTTCCCAGAAGCGG

SNP: A/C

3': CCTGAGGACCCCTTGGCCCTGGCCTTCAAA


M14780

5': GGAGAAGAAGTTGGAGAAAGGCCAGTCCAT

SNP: C/T

3': GACGACATGATCCCCGCCCAGAAGTAGGCG


X00567

5': GGATGCCTCCCTTCTCAGCTTCATGCAGGG

SNP: T/C

3': TACATGAAGCACGCCACCAAGACCGCCAAG


X54802

5': GAAGGCCTCCTGGAGCAGCCTCTCCATGGA

SNP: T/C

3': GAGAAAGTCGAGTTGTATCGCATTAAGTTC


X15606

5': GGCTTGGAGGAGGCTGCCCCAGGCCTTCCG

SNP: G/A

3': CCATAGCAACCATGAGTGGCATGGCCCACA


X14829

5': CGTGTGCAACAGCAAGGACGGCGGGGCCTG

SNP: G/A

3': GGGACCGAGCAGCGGGAGGCTGTCTTTCCC


X14829

5': CAACAGCAAGGACGGCGGGGCCTGGGGGAC

SNP: C/T

3': GAGCAGCGGGAGGCTGTCTTTCCCTTCCAG


U43527

5': TGTCCCCGCCCCCCGAGAGCTCCGGGAGCC

SNP: G/C

3': CCAGCAGCCGGGCCTGTCCGCCCCCCACAG


Y00503

5': GAACTCCAGGATTGTCCTGCAGATCGACAA

SNP: C/T

3': GCCCGTCTGGCTGCAGATGACTTCCGAACC


Y00503

5': CCCGCTTTGTGTCCTCGTCCTCCTCGGGGG

SNP: G/C

3': CTACGGCGGCGGCTACGGCGGCGTCCTGAC


M13755

5': TGGTGGTGGACAAATGCGACGAACCTCTGA

SNP: G/A

3': CATCCTGGTGAGGAATAACAAGGGCCGCAG


X65614

5': GACCAAGGGGGAGCTCAAGGTGCTGATGGA

SNP: G/T

3': AAGGAGCTACCAGGCTTCCTGCAGAGTGGA


X67698

5': GCATCCTGATGGGCGTCCCAGTTCCCTTTC

SNP: C/T

3': CATTCCTGAGCCTGATGGTTGTAAGAGTGG


U30897

5': GACGGCGTGGAGGACCTCCGCTGCAAATAC

SNP: G/A

3': TCTCCCTCATCTACACCAACTATGAGGCGG


U30897

5': CCTGCTCTCAGCATATGTGGGGCGCCTCAG

SNP: T/C

3': GCCCGGCCCAAGCTCAAGGCCTTCCTGGCC


X17042

5': TGAGGACTACTCTGGATCAGGCTTCGGCTC

SNP: C/T

3': GGCTCCGGCTCTGGATCAGGATCTGGGAGT


U87947

5': GCCTTGATCTATGCCATTCACGCCGAGGAG

SNP: A/G

3': TCCTGGAGAAGCACCCGCGAGGGGGCAGCT


M22430

5': AAAGGAAGCCGCACTCAGTTATGGCTTCTA

SNP: C/T

3': GGCTGCCACTGTGGCGTGGGTGGCAGAGGA


S71513

5': AGATGCAATCAATGCCCCAGTCACCTGCTG

SNP: T/C

3': TATAACTTCACCAATAGGAAGATCTCAGTG


D90209

5': TGGTGGGGGACTTGATGTCCCCCTTCGACC

SNP: C/A

3': GTCGGGTTTGGGGGCTGAAGAAAGCCTAGG


U96915

5': GTTGCAGATCTACACTTGGATGGATGCAAC

SNP: T/C

3': TTGAAAGAACTGACAAGCTTAGTAAAAGAA


U37690

5': GCTGCTGCAGGCCGAGTACACCGAGGGGGA

SNP: C/T

3': GCGCTGGATGCCCTGGGCCTGAAGCGCTAC


M74524

5': TGAAAAGCGTGTTTCTGCAATAGTAGAACA

SNP: A/G

3': AGCTGGCGTGATTGTTGACCCCGGGTACAG


M11354

5': GCGCTTCCAGAGCGCAGCTATCGGTGCTTT

SNP: G/C

3': CAGGAGGCAAGTGAGGCCTATCTGGTTGGC


D50663

5': CACCAAGCTGGGAAAACCATTTAAATACAT

SNP: C/T

3': GTGACCTGTGTAATTATGCAGAAGAATGGA


X02598

5': TGGACTCTTGCACATCACTACCTGCAGTTT

SNP: T/C

3': GTGGCTCCCTGGAACAGCCTGAGCTTAGCT


L03558

5': CTCCGTCGCCGCCAAGATGATGTGCGGGGC

SNP: G/T

3': CCCTCCGCCACGCAGCCGGCCACCGCCGAG


J04205

5': CGGGTGATTTAGATGATCAGACCTGTAGAG

SNP: A/T

3': AGATTTACACATACTTTTCTCAAATCATGG


D13891

5': CCAGGCGTCCAGGACGCCGCTGACCACCCT

SNP: C/T

3': AACACGGATATCAGCATCCTGTCCTTGCAG


X83218

5': AATTAAAAACTGTCCTCAAGAGCTTCCTAA

SNP: G/A

3': TCAAGGCCAAGTATTGAAATTGGAGGCTAA


X83218

5': GCAATACCCAAGGAGTCGTTTCTGCCTTTT

SNP: C/T

3': TACCATGATGAGTGTCCATCGCGGAGAGGT


X83218

5': AAAAGAGAGGTTCTCTCCCCTCACTACCAA

SNP: C/T

3': CTGATCAATTTGCTTGCTGAAAATGGTCGA


X83218

5': AAGTGAAAAGCCTAAATGACATCACAGCAA

SNP: A/G

3': AGAGAGGTTCTCTCCCCTCACTACCAACCT


X15002

5': AGAGATCAGGGGAGACCCCAACTGCCAGAT

SNP: A/G

3': TATTTTAATGTACAAAACTGAAACCAGATG


L02426

5': CCCGATGTCAGTAGGAACCTTGGAAGAGAT

SNP: T/C

3': ATTGATGACAATCATGCCATCGTGTCTACA


M86667

5': GATAGAAGCCAAATTCTATGAGGAAGTTCA

SNP: T/C

3': GATCTTGAAAGGAAGTATGCTGTTCTCTAT


M69013

5': GATGGAGGAGAGCAAAGCCCTGTTCCGGAC

SNP: C/T

3': ATCATCACCTACCCCTGGTTCCAGAACTCC


X80909

5': CGATGAAACAGGTGTAGAAGTTAAGGACAT

SNP: T/A

3': GAATTGGTCATGTCACAAGCAAATGTGTCG


X80909

5': TAGAGTCACTATCCGGAAATCTAAGAATAT

SNP: A/C

3': CTCTTTGTCATCACAAAACCAGATGTCTAC


X80909

5': ACAAGCCCAGCTGGCGGCACGAGCTGAAAT

SNP: T/C

3': GATGAAGAACCAGTCAGTAAAGCAAAACAG


Z19554

5': CAAGCCTGACCTCACGGCTGCCCTGCGTGA

SNP: C/T

3': GTACGTCAGCAATATGAAAGTGTGGCTGCC


M63573

5': GCTCCTTGCCGCCGCCCTCATCGCGGGGTC

SNP: C/A

3': GTCTTCTTCCTGCTGCTGCCGGGACCTTCT


L08187

5': GAGTGACTGGAGTCTCCCCGCCACTGCCAC

SNP: A/G

3': ATGAGCCTGGGCAAGTAGCAAGGGCTTCCC


L08187

5': AGGGCTGTGCGGCCCCGAGCCAGGTACTAC

SNP: G/A

3': TCCAAGTGGCGGCTCAGGACCTCACAGACT


M65212

5': TGACACCAAGGAGCAGCGCATCCTGAACCA

SNP: C/T

3': GTGCTGCAGCATGCGGACGCCGGGAACGCA


M65212

5': GGCCCGCCTGCTGTCACCAGGGGCGAGGCT

SNP: C/G

3': ATCACCATCGAGATCAACCCCGACTGTGCC


M65212

5': ATCACCCAGCGGATGGTGGATTTCGCTGGC

SNP: G/A

3': TGAAGGACAAGGTCACCCTTGTGGTTGGAG


D26598

5': GCAGACAGGCGCTTCGGGATCCAGGCCCAG

SNP: T/A

3': TGGTGACCACGGACTTCCAGAAGATCTTTC


M13451

5': GGATGGAGATGACCTGCTCCATCACCACCA

SNP: C/T

3': GTGAGTGGTAGCCGCCGCTGAGGCCGAGCC


X90583

5': CGTGCTCCTGCTGTCCAGCCTCTCCCGCTG

SNP: C/T

3': TCAGCCGAGGCCTGCCTGGAGCCCCAGATC


U09202

5': ATAAACCCAGCGCCACCATCCACGCCAGCC

SNP: G/T

3': CACCATGCCGCTCCTAAGCCTGCACAGCCG


X55885

5': CTTGCCGCAGCTGTTCATGGTGAGCAAGAC

SNP: C/A

3': GGCGAGGCGGAGACCATCACCAGCCACTAC


M73791

5': CAGATGGCTGTGGGGTCAAGTACATCCCCA

SNP: G/A

3': TCGTGGCCCTCTGGACAAGTGGCGGGCCCT


M73791

5': AAACAGGCATGCGAGGTGCCTTTGGAAAGC

SNP: C/T

3': CCAGGGCACTGTGGCCAGGGTTCACATTGG


L26247

5': GGCACTGAGGATTATATCCATATAAGAATT

SNP: C/A

3': AACAGAGAAACGGCAGGAAGACCCTTACTA


M12654

5': TAAAAGCAAAATTGCCTGATGCCACACCCA

SNP: C/A

3': GGAACTGGCAAAGCTGGTTAACAAGCGCTC


M12654

5': ATCCACAAAGAATTCTAAGTTTGAAGACTG

SNP: T/C

3': TGTCAAGAAAAAACAGCCATGGACGTTTTT


S81585

5': GAAAGAATATTTGATCATGGGCATGGGTCT

SNP: G/A

3': GATGGGGCCACCTATGACCTCGAGGGACAC


M26708

5': GACGATGTCGATACCAAGAAGCAGAAGACC

SNP: G/A

3': ACGAGGATGACTAGACAGCAAAAAAGGAAA


X59417

5': AGTGAAGAAGAAATTTGATTGGACATTTGA

SNP: A/G

3': CAGACAGTGGAAACTGCAATTACATGCCTG


L20688

5': AGTTGAGGAGGCTCCCAAGGGCATGCTGGC

SNP: C/G

3': CGAGGCACGTACCACAACAAGTCCTTCTTC


D38048

5': TTGCAAAGAGGGGATACAAGCTTCCAAAGG

SNP: T/C

3': CCGGAAAACTGGCACGACCATCGCTGGGGT


S76822

5': CGCTCAGCAGCAGCCTGAAAACTTGCTACA

SNP: G/A

3': GTATCTCAATCAGACCAGTCGCAGTTTCGC


L06132

5': TAAAGCCAGGTATTAAACTGACACTGTCAG

SNP: C/T

3': TCTTCTGGATGGCAAGAACGTCAATGCTGG


X15341

5': CCTACCCCCATCTCCGCATCAGGACCAAGC

SNP: C/T

3': GTTTCCCTGGGGAGATGGTAACCATACTCT


M86511

5': GTCGGTGGGGGTGTCGGGAACCCTGGTGCT

SNP: G/C

3': CTCCAAGGGGCCCGGGGCTTTGCCTAAGAT


X89750

5': AGAGGACACTTGTAAATCTGGACCAAGTAC

SNP: G/C

3': AATACACAGAGTGGTCTTTTCAACACTCCT


U18423

5': AATCTGTGAAGTAGCTAATAATATAGAACA

SNP: G/A

3': AATGCTCAAGAGAATGAAAATGAAAGCCAA


U18423

5': TGGCTATCATACTGGCTATTATATGGGTTT

SNP: C/T

3': AGACAAAATCAAAAAGAAGGAAGGTGCTCA


U60644

5': CTGGTCTGGCAACTACTTCACGGAGACGGC

SNP: G/A

3': GGCACCTCGCTGCTGGTGACGCAGAATGGG


D90373

5': AAGAATGTTGGTTGGCGCCTTGATTACTTT

SNP: T/C

3': TGTTGTCCCACTCTCTGTTACCTGCATTGT


M16961

5': CCTCGTCCTGCTCCTTTGTCTTGCTCAGCT

SNP: C/G

3': TGGGGCTGCCACTCAGCCCCACATGGCCCA


M16961

5': TTGGTGGGGCAGAGGTTGCAGTGACCTGCA

SNP: C/T

3': GGTGTTCCAAACACAGCCCGTGACCTCACA


M16961

5': CCTGCACGGTGTTCCAAACACAGCCCGTGA

SNP: C/G

3': CTCACAGCCCCAACCAGAAGGTGCCAATGA


S80305

5': GCCATGCCAAGTTGTAAAGCATCTTGTAAA

SNP: G/T

3': TACCTGTGAAAAAAGCCACTGTGGTGTACC


D90427

5': GGACATCTTTATGGAGACCCTGAAAGACAT

SNP: T/C

3': GTGGAGTATTACAACGACAGTAACGGGTCT


U12404

5': TTCTTGGTGTCATTGCTCAAGAAAAACTGG

SNP: C/A

3': AGAATGTCCGGGCCTTATATATCAAGAGCA


X56740

5': GCATTGTTTCTCAGAAGCAAATGTCAGACA

SNP: G/T

3': ACGCGAAAATGACATGTCTCCAAGCAACAA


X56740

5': TATTCATGTTCCACCAACCACTGAAAACAA

SNP: G/T

3': CCAAAGGTGCAGTGCTGTCAGAACATCTAA


J04965

5': CCAATTTGGGGACAAGCCGAGTGAGGGGCG

SNP: G/T

3': CCGCGGCGCACGGACCTCACCGTGCTGGTG


U51007

5': AGTTCCTTCAGAGTGTCCTAGAGAACCTCC

SNP: C/G

3': AGGTGTGGATCCCAACAATGAAGCCATTCG


S67861

5': ACTGTAGATTCCATGGACGAGGAGAAAATT

SNP: G/A

3': AAGAATATCTGAAGCGACAGGGTATTTCTT


M74220

5': TGTCCTGCTTCCAGATGTAGAGACTCCTTC

SNP: C/T

3': GAAGAAGACTGTATGTTTGGGAATGGGAAA


M74220

5': CTCAGAGTGCAAGACTGGGAATGGAAAGAA

SNP: C/T

3': TACAGAGGGACGATGTCCAAAACAAAAAAT


X75861

5': CAGCATCCTTCCCACTGCTTTCATGGGCAC

SNP: A/G

3': GCAATGATCTTTACCTGCTTCACCCTCAGT


U17248

5': AACGGAGACAAATATCTGGGGCCTGCAGTT

SNP: C/T

3': TTATGCAGGCCTATCGCTGGATGATTGACT


X02152

5': TGGTTTTCCCAAAAACCGTGTTATTGGAAG

SNP: T/C

3': GGTTGCAATCTGGATTCAGCCCGATTCCGT


X02152

5': CAATCTGGATTCAGCCCGATTCCGTTACCT

SNP: G/A

3': ATGGGGGAAAGGCTGGGAGTTCACCCATTA


X64364

5': CCAGCTCCACGGGCCTCCCAGAGTGAAGGC

SNP: C/T

3': GTGAAGTCGTCAGAACACATCAACGAGGGG


L35233

5': CAGCAGGCAGCTTCTACTCCTGCCTCATGC

SNP: A/G

3': TACGTCCCACAAATGCAGGTGTCCTGAGCA


U28386

5': TCGGCTCCTGCATCATGATGATCCAGAAGT

SNP: G/A

3': TTAGCAGATACCTGCTGGGCTATTTCCTAC


U90313

5': TTATTAGAAGCCAAAATAAAGAAGACTATG

SNP: C/A

3': TGGCCTAAAAGAAGAATTTCGTAAAGAATT


M13690

5': GTCTTTGAAGTGCAGCAGCCCTTCCTCTTC

SNP: G/A

3': TGCTCTGGGACCAGCAGCACAAGTTCCCTG


M94083

5': AGTTAAAATTCAAGCAGAACATTCAGAATC

SNP: A/G

3': GGTCAGCTTGTGGGTGTGGACCTGAACACA


D55716

5': CCGTGAACTGGTCTCAGGGGGCCGAAGTGT

SNP: C/G

3': CGGTTCTCTGAGGCAGAGCAGCGCTGTGTA


D55716

5': GACAGCTAGGACTCAGAGACCAGCAGATGT

SNP: G/C

3': ATATTTGCCACCGTCCGTGAACTGGTCTCA


J04599

5': CGATGAGGAAGCTTCGGGCGCTGACACCTC

SNP: A/G

3': GGCGTCCTGGACCCGGACTCTGTCACACCC


X93499

5': CACAGCAGGACAGGAACGGTTCCAGTCTCT

SNP: C/T

3': GGTGTGGCCTTCTACAGAGGTGCAGACTGC


X76648

5': GGGAGCAAGAACGGTGCCTCGAGTCTTTAT

SNP: T/C

3': GGTAAAGATTGTATAGGCGGATGCAGTGAT


X76648

5': CCCATCAAACAAGGGCTTCTGGAATTTGTC

SNP: G/T

3': ATATCACAGCCACCAACCACACTAACGAGA


X97442

5': TGACTGGCGCGTACGAGATCTCCGACCAGT

SNP: C/A

3': TGGGGGCGCTGGCGGCCTGCGCAGCCACCT


X97442

5': GGTCCTATACTTCAGCATCTTTTCAATGTT

SNP: C/T

3': TGTCTCATTGGACTAGCTACCTGGCAGGTC


AF006084

5': GACCAAGGTGCACGAGCTCAAGGAGCACAA

SNP: C/T

3': GGGCAGGTGACAGGCATCGACTGGGCCCCC


S82024

5': TTAAGGAAAACCGTGAGGCTAATCTAGCTG

SNP: C/G

3': TATTATTGAACGTCTGCAGGAAAAGGAGAG


M36682

5': GCCTACCCATCTTCTGGACAGCCAAGTGCC

SNP: C/A

3': CCGGAGCCTACCCTGCCACTGGCCCCTATG


M36682

5': ATCCTGGACAGGCACCTCCAGGCGCCTACC

SNP: A/C

3': TGGAGCACCTGGAGCTTATCCCGGAGCACC


D00682

5': GGTGGGCGATGTGGGCCAGACTGTCGACGA

SNP: T/C

3': CCCTACGCCACCTTTGTCAAGATGCTGCCA


S83285

5': TGACACACAATTGGGGCACTGAAGATGATG

SNP: A/C

3': GACCCAGAGTTACCACAATGGCAATTCAGA


X57346

5': GAAAGCCAAACTCGCTGAGCAGGCTGAGCG

SNP: C/A

3': TATGATGATATGGCTGCAGCCATGAAGGCA


U90551

5': GCCGGTGTACCTGGCGGCGGTGTTAGAGTA

SNP: C/T

3': CTGACCGCCGAGATCCTGGAGCTGGCCGGC


K02215

5': TCACTTTCCAGCAAAACTCCCTCAACTGGA

SNP: T/A

3': GAAGAAAGTGTCTCCCCGGACCATCCACCT


K02215

5': TGACAGGATGGAAGACTGGCTGCTCCCTGA

SNP: T/C

3': GGGAGCCAGTGTGGACAGCACCCTGGCTTT


K02215

5': CTGATAGCCAGGCCCAGCTGCTGCTGTCCA

SNP: C/T

3': GGTGGTGGGCGTGTTCACAGCCCCAGGCCT


U18321

5': CCTAGTGGCCGTGGATGGAATCAATGCTCT

SNP: T/C

3': TGGGGAAGAACCACTCTGAAAAGAGAAGAT


M77349

5': CCTCAACCGGGAAGGAGTCTACACAGTCTT

SNP: T/C

3': GCTCCCACAAATGAAGCCTTCCGAGCCCTG


D38305

5': GTTTGCAGCCTATGGAGGCCTCAATGAGAA

SNP: G/A

3': TCTTTTGTAGATGGCTTGAATTTTAGCTTA


L19437

5': AAAGCTGTCATCAACCTGGGAAGGAATTCA

SNP: G/T

3': GCTGGAAAGGAGCTCGAGGAGCAGCACGGC


K01500

5': TTGAGAATGGAGAGAATGTTACCTCTCCTG

SNP: G/A

3': CTCTGGGGCTCTTGGCGGCTGGGTTCTGCC


X67688

5': AGTTAACCGGGTACCAAGAAGTGGGAAGCC

SNP: A/G

3': GCTGAGCTGCTGAAGATGTTTGGTATCGAC


U46751

5': CAGCTCACAGCCAAGCAGCTGCTGCTCTGA

SNP: C/T

3': CCCAGCAAGCCGGGTGGGAATGTTGAGGGC


U46751

5': CGCCACGCAGTCTCTGGCGGAGCAGATGAG

SNP: G/A

3': AAGATCGCCTTGGAGTCCGAGGGGCGCCCT


X83618

5': TCCACTCACAATGGGAACATGTACACCTCA

SNP: T/A

3': CCCTGTACGGGTGCCTGGCCTCGCTTCTGT


D49489

5': TAGTGATGATGTGATCGAATTAACTCCATC

SNP: A/G

3': AATTTCAACCGAGAAGTTATTCAGAGTGAT


D49489

5': CCAGCTCGTGAAGGATCGCCTCGGGGGACG

SNP: G/A

3': AGCGGAGGATACAGTTCTGGAAAACAAGGC


D49489

5': CTTCAGAAGTAAAAGAGCAGACGAAAGGAA

SNP: A/G

3': AGTGAAACTGGCAGCTGTGGATGCTACAGT


AF008443

5': CTGGGTTCAGATTGATGCCAATTCCTCAGT

SNP: C/T

3': CTTCATGATGAATTCATTGCTCACAGGCTT


U09510

5': AGTCCAAGACCTAGCCAATGGCAACATCAC

SNP: A/G

3': TGGGCTGATGTGGAGGCCAGGTATCCTCTG


X70218

5': ATTGACATGATCTGCCGTGCCCACCAACTG

SNP: G/T

3': TGATGGAAGGTTACAAGTGGCACTTCAATG


U31525

5': GGCAACAACAGATATCAGAAAACACCTGCC

SNP: A/G

3': TTTATTTATAACCTAAGCAGCATCTCTATA


D29643

5': CGTGGAGACCATCAGTGCCTTTATTGACGG

SNP: C/T

3': GGAGGCAGTGTGCTGGTAGCTGCCAGCTCC


X56468

5': GACTCATACAAAGACAGCACCCTCATCATG

SNP: C/T

3': AGTTGCTTAGAGACAACCTAACACTTTGGA


M29870

5': GCAGGGTCTAGCCATGGCTAAGGAGATTGG

SNP: T/C

3': GCTGTAAAATACCTGGAGTGCTCGGCGCTC


L08488

5': GAACAAGAAGTTTGCAGTTGACTTCAAGAC

SNP: T/G

3': CTGGCTGATGTACTGGTACAGGAAGTTATA


L08488

5': TCTTAGCAAAGTCCTCAATGGTAACAAGGT

SNP: A/G

3': GCATCTGAAGCATTAGCCAGGGTTGTTCAT


J04765

5': GTAAGGAAGAAGATAAACACCTGAAATTTC

SNP: G/A

3': TATTTCTCATGAATTAGATAGTGCATCTTC


J04765

5': CATGGATGATATGGATGATGAAGATGATGA

SNP: T/C

3': GACCATGTGGACAGCCAGGACTCCATTGAC


J02853

5': GCCAAGCAGGGCCAGAGTTTACACAGATGT

SNP: T/C

3': AATACACACAGACCTCGAGAATACTGGGAT


M22960

5': TTTCCTGACCGGGGAGAGCTATGCTGGCAT

SNP: C/A

3': TACATCCCCACCCTGGCCGTGCTGGTCATG


L16510

5': TACCGAGGACCTGAAGCTGCCTGCAAGCTT

SNP: C/T

3': GATGCACGGGAACAATGGCCACAGTGTCCC


M57730

5': GCAAAATCACTCACAGTCCTCAGGCCCATG

SNP: T/A

3': CAATCCACAGGAGAAGAGACTTGCAGCAGA


M90657

5': CGGCCAGTGGAACTACACCTTTGCCAGCAC

SNP: C/T

3': GAGGGCCAGTACCTTCTGGATACCTCCACA


Y00282

5': ATGTTCCAGACCTTGAAGTACCTGGCCATC

SNP: T/C

3': TGGGCAGTGTGACGTTTCTGGCTGGCAATC


X97544

5': CTGGCAGCAAGAAATGGACCAGTGGCCATG

SNP: G/A

3': TTGGGTCAGCCGCAATGGGTGGCATTCTCC


U38846

5': TGTAGATCTTAGAGATATTAAAATAGTTAA

SNP: G/T

3': AAGCTTGGTGGGACAATTGATGACTGTGAG


X79353

5': CTGAGTCGATGGGCCGAGGCGAGACTGGAA

SNP: T/C

3': GTTGACCTGATTCCCAAATTCCTCATGGCT


J04973

5': TCATTGAAAATTTGCATGCAGCAGCTTACC

SNP: A/G

3': GAATGCCTTGGCTAATCCCTTGTATTGTCC


D50310

5': ACATTTGCTCTGGCTAGCAGTCTTTTGGAT

SNP: A/G

3': GGTTTTTAGCTACCGTAAAGGCTCATCCAA


J03569

5': TCTGGTTCTACTGGGGAGCATACAAAATCC

SNP: C/T

3': TAGTCACACAGTATTTGAATGCCACTGGCA


L13977

5': GCAGAATATTTTCCAAGCTCTGAATGTATA

SNP: T/C

3': TACAATTATTCGGGCCAGGTGAAATGCCTG


L13977

5': GAATTGGATCAGAGATTTCTATGACAGTGC

SNP: A/G

3': GGAAAGCAGCACTGAGAAACTTTTGATTGT


U80073

5': GTACTATGCAATTTACGACTCTGGAGACCG

SNP: A/G

3': CAAGGGCTCCTGGATGCCTACCATGATGGG


L12136

5': GACCGATGTGAAAGGCTGTAGTATGTATGT

SNP: C/T

3': GCCTTGTTCCCTTGTAATGAATGCGCTAAG


X97124

5': TGAAGTCATTCAGCAAAAAGAAAGGTGAGC

SNP: A/C

3': GCCAACAGGCCAGCAGCGGCGGAAACACCA


D21235

5': GCGAGAGCGGGTCGTGGCCGCCCTGAGAGC

SNP: C/T

3': AGCTACAACAACCCCCACCGAGCCGTGGAG


U58516

5': TTCCAGCGCCCGCGTCCCCGCAGCATGCCG

SNP: C/A

3': GCCCCCGCCTGCTGGCCGCGCTGTGCGGCG


U03269

5': TGCCCCTCCTGGAGAATTTAATGAGGTTTT

SNP: C/T

3': AATGATGTTCGGTTACTGCTTAATAATGAC


X04076

5': TTTGGTGCTCCGGAACAACAGCCTTCTGCC

SNP: C/T

3': TGGAGCACAGCATCCAATATTCTGGAGAAG


L18960

5': TGATGAAATTCAGTTTGATGACATTGGAGA

SNP: T/C

3': GATGATGAAGATATTGATGACATCTAAATT


X15183

5': TCTGTTTGAAAACAGAAAGAAAAAGAACAA

SNP: T/C

3': ATCAAATTGTATGTACGCAGAGTTTTCATC


U58996

5': CTCTTAAATTTGAAGATGCTAAACTTGCTG

SNP: C/T

3': TGCCATCTCTGAAGTGGTTTCCCAAACCCC


U06643

5': GGGCTCCGATGCCGCGCTGCATTTCAACCC

SNP: C/A

3': CGGCTGGACACGTCGGAGGTGGTCTTCAAC


References

1. Wu C, Nagasaki H, Maruyama K, Nakabeppu Y, Sekiguchi M, Yuasa Y
Polymorphisms and probable lack of mutation in a human mutT homolog, hMTH1, in hereditary nonpoliposis colorectal cancer. Biochem Biophys Res Commun. 1995 Sep 25;214(3):1239-45.
PubMed ID : 7575536

2. Tsai W, Clarke S
Amino acid polymorphisms of the human L-isoaspartyl/D-aspartyl methyltransferaseinvolved in protein repair. Biochem Biophys Res Commun. 1994 Aug 30;203(1):491-7.
PubMed ID : 8074695

3. SwissProt Accession : P11686

4. Poller W, Faber JP, Weidinger S, Tief K, Scholz S, Fischer M, Olek K, Kirchgesser M, Heidtmann HH
A leucine-to-proline substitution causes a defective alpha 1-antichymotrypsin allele associated with familial obstructive lung disease. Genomics. 1993 Sep;17(3):740-3.
PubMed ID : 8244391

5. Jeunemaitre X, Soubrier F, Kotelevtsev YV, Lifton RP, Williams CS, Charru A, Hunt SC, Hopkins PN, Williams RR, Lalouel JM, et al
Molecular basis of human hypertension: role of angiotensinogen. Cell. 1992 Oct 2;71(1):169-80.
PubMed ID : 1394429

6. von Eckardstein A, Funke H, Walter M, Altland K, Benninghoven A, Assmann G
Structural analysis of human apolipoprotein A-I variants. Amino acid substitutions are nonrandomly distributed throughout the apolipoprotein A-I primary structure. Biol Chem. 1990 May 25;265(15):8610-7.
PubMed ID : 2111322

7. Braun A, Bichlmaier R, Cleve H
Molecular analysis of the gene for the human vitamin-D-binding protein (group-specific component): allelic differences of the common genetic GC types. Hum Genet. 1992 Jun;89(4):401-6.
PubMed ID : 1352271

8. Bock SC, Skriver K, Nielsen E, Thogersen HC, Wiman B, Donaldson VH, Eddy RL, Marrinan J, Radziejewska E, Huber R, et al
Human C1 inhibitor: primary structure, cDNA cloning, and chromosomal localization. Biochemistry. 1986 Jul 29;25(15):4292-301.
PubMed ID : 3756141

9. Osawa M, Umetsu K, Ohki T, Nagasawa T, Suzuki T, Takeichi S
Molecular evidence for human alpha 2-HS glycoprotein (AHSG) polymorphism. Hum Genet. 1997 Jan;99(1):18-21.
PubMed ID : 9003486

10. SwissProt Accession P17931

11. SwissProt Accession Q00059

12. Li T, Vallada H, Curtis D, Arranz M, Xu K, Cai G, Deng H, Liu J, Murray R, Liu X, Collier DA
Catechol-O-methyltransferase Val158Met polymorphism: frequency analysis in Han Chinese subjects and allelic association of the low activity allele with bipolar affective disorder. Pharmacogenetics. 1997 Oct;7(5):349-53.
PubMed ID : 9352569

13. SwissProt Accession P27635

14. SwissProt Accession P37268

15. Steinkasserer A, Dorner C, Wurzner R, Sim RB
Human beta 2-glycoprotein I: molecular analysis of DNA and amino acid polymorphism. Hum Genet. 1993 May;91(4):401-2.
PubMed ID : 8099061

16. Ridderstrom M, Mannervik B
Optimized heterologous expression of the human zinc enzyme glyoxalase I. Biochem J. 1996 Mar 1;314 ( Pt 2):463-7.
PubMed ID : 867005

17. Luthman H, Soderling-Barros J, Persson B, Engberg C, Stern I, Lake M, Franzen SA, Israelsson M, Raden B, Lindgren B, et al
Human insulin-like growth-factor-binding protein. Low-molecular-mass form: protein sequence and cDNA cloning. Eur J Biochem. 1989 Mar 15;180(2):259-65.
PubMed ID : 2466665

18. Rosenblum JS, Gilula NB, Lerner RA
On signal sequence polymorphisms and diseases of distribution. Proc Natl Acad Sci U S A. 1996 Apr 30;93(9):4471-3.
PubMed ID : 8633092