Documentation for pcr_overlap
Last updated: 21 Oct 1999
Program Description:
--------------------
This program will take large tracks of sequence data in FASTA file format, and produce PCR products in
overlapping seqments to span the entire region. This program is written to divide up the given
sequence, based on the users criteria for PCR product size and overlap between adjacent segments, and
pass this data to the PCR primer selecting program 'Primer3', written at the Whitehead Institute.
Primer3 then chooses primer sets based on specific selection criteria. The output file is a list of
primer sets consisting of the primer sequence, melting temperature (Primer3 calculated), primer set
"quality" (lower is better;Primer3 calculated), primer positions, primer lengths, PCR product length,
and amount of overlap between adjacent fragments.
Usage: pcr_overlap
**Note: You need to install the program Primer3 on your system before running pcr_overlap.pl.
Primer3 can be found at the website: http://www-genome.wi.mit.edu/
Program Input:
--------------
pcr_overlap has been made completely command-line input format (no more interactive input).
pcr_overlap [-file] [-gene]
<-start>
<-size>
<-overlap>
<-nouniv>
[-file] required fasta input file where you want to select your primers.
[-gene] "basename" which will be added to all of your primer names.
optional input:
<-start> = start position for picking primers in your sequence
<-size> = average size of pcr product (default is 1000+-15%). If you give it a size it will always have a range of +- 15%
<-overlap> = average overlap size between fragments (default is 180+-30%) again if you give a value range will be +-30%
<-nouniv> = this is a switch. If you DO NOT want universal tails on your sequences, use it. (default is with universal tails)
Output:
"basename".primers.fasta = fasta file output of primers numbered using nonmenclature (0 = for, 1 = rev)
"basename".primers.txt = text output of primer pairs with additional information
Notes:
# The amount of overlap is calculated from the 5' end of a fragment
to the 3' end of the previous
(adjacent) fragment and takes into account the primer lengths.
Generally, we have found that when
sequencing off of these PCR products with dye-primer sequencing an
overlap 150-200 bp is best. #
# The range between the maximum overlap and minimum overlap defines
the search region when looking
for a primer on the 5' end of each product.
# If the program fails to pick primers across your entire region
you can change the input parameters
Generally increasing the -overlap helps the most.
You can also restart the program from the failure point
using the -start parameters.
# The universal 5' tails are used for DNA sequencing of the PCR product. These tails
are compatible with the Perkin-Elmer Dye Primer sequencing kits.
Universal forward = TGTAAAACGACGGCCAGT
Universal reverse = CAGGAAACAGCTATGACC
Typical output:
Picking primer set 1...
Picking primer set 2...
Picking primer set 3...
Picking primer set 4...
Picking primer set 5...
Picking primer set 6...
Picking primer set 7...
Picking primer set 8...
# Messages are given to let one know the program is proceeding.
An error message is given if
primers cannot be chosen. If primers are not found you have several
options:
1) Change the product size range, overlap values, or starting point
2) Adjust the parameters used by Primer3 to pick primers. These
parameters are currently integrated
into the program (pcr_overlap.pl) but can be easily changed by editing
the program. An explanation of the
primer picking parameters comes with the primer3 documentation or can be
found on their webpage. #
Program Files/Output:
---------------------
The program writes to the file 'p3_input' to pass the search parameters
and sequence data to primer3.
The search results are redirected to the file 'out'. The results
are then read and used to for the
next round of primer selection. The final set of primers are written
to the file basename.primers.txt and
basename.primers.fasta (see
below)
Explanation of the output file (basename.primers.txt):
Search parameters used:
Range: 850-1150 (default)
Frag. Overlap: 126-234 (default)
Start Site: 150 (default)
# The search parameters are echoed to the output file
#
ttctgtaaatgccacgtttcc 59.989 # Forward primer and melting
temp #
aaatttcggccttgctttg 60.195 # Reverse primer
and melting temp #
2.2060
# Primer quality - (Primer3) #
6.00 4.00
# Left and right primer self-complementarity score (Primer3) #
4.00 4.00
# Primer pair complementarity and 3' complementarity score (Primer3)
#
159 21
# Forward primer position (5') and length #
1018 19
# Reverse primer position (5') and length #
860
# Product size (including primers) #
# All primer output is 5'-3';Primer quality is also calculated by
primer3 -- lower is a higher
quality primer set #
# 2nd primer set #
tcactcttgcttctgctgga 59.855 # Same as above #
accttcaaaattcaggctgc 59.316
0.8283
5.00 2.00
3.00 3.00
762 , 20
1707 , 20
945 , 216
# Product size and overlap with previous fragment #
....
# other primer sets #
# Primer set statistics #
Summary Statistics for Primer Sets:
Ave. Frag. Size = 980 +/- 35
# Average fragment size and S.D. #
Ave. Overlap = 197 +/- 5
# Average overlap and S.D. #
Other Information:
------------------
Any questions or to report program bugs contact mrieder@u.washington.edu
/******************************************************************************
*
*
* Program: pcr_overlap
*
* Version: 0.970625
*
* Copyright (C) 1996-1997 by Deborah A. Nickerson and Mark J. Rieder
*
* University of Washington
*
*
*
* All rights reserved.
*
*
*
* This software is provided ``AS IS'' and any express or implied
*
* warranties, including, but not limited to, the implied warranties
of *
* merchantability and fitness for a particular purpose are disclaimed.
*
* In particular, this disclaimer applies to any diagnostic purpose.
In no *
* event shall the authors or the University of Washington be liable
for *
* any direct, indirect, incidental, special, exemplary, or consequential
*
* damages (including, but not limited to, procurement of substitute
goods *
* or services; loss of use, data, or profits; or business interruption)
*
* however caused and on any theory of liability, whether in contract,
*
* strict liability, or tort (including negligence or otherwise) arising
*
* in any way out of the use of this software, even if advised of
the *
* possibility of such damage.
*
*
*
******************************************************************************/